Detail Information of mm0000066 [Genome Browser]
1.Basic Information

Name: mm0000066
Species: Mus musculus
Cell Line: 3T3-L1
Restriction Enzyme: Csp6I

2.Experiment Infromation

Remark: conrol: nearby locus; PPARγ binding sites
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Ucp3,intron 1 7:100474188-100475037 AGCCAAGCCTTGCTGCTCTTCTG +
Target
Locus2 Fragment location Primer sequence Strand
Ucp2,promoter 7:100492672-100495117 TTGTCCTAGCTTTTGATGTCCCTG +

4.Reference

Bugge, A., et al. (2010). "A novel intronic peroxisome proliferator-activated receptor gamma enhancer in the uncoupling protein (UCP) 3 gene as a regulator of both UCP2 and -3 expression in adipocytes." Journal of Biological Chemistry 285(23): 17310-17317.   PMID: 20360005

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.