Detail Information of mm0000060 [Genome Browser]
1.Basic Information

Name: mm0000060
Species: Mus musculus
Cell Line: erythroid cells
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Lmo2, proximal promoter 2:103969249-103972076 AGGAGAGAAACAACAACCCTTT +
Target
Locus2 Fragment location Primer sequence Strand
Lmo2,distal regulatory element,segment 75 2:103889261-103891426 TGCTTGATCATGGTTACAGGTC -

4.Reference

Bhattacharya, A., et al. (2012). "Upstream distal regulatory elements contact the Lmo2 promoter in mouse erythroid cells." PLoS One 7(12): e52880.   PMID: 23285212

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.