Detail Information of mm0000048 [Genome Browser]
1.Basic Information

Name: mm0000048
Species: Mus musculus
Cell Line: limb buds
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: compare E10.5 forebrain, E10.5 tail bud, and E12.5 limb bud
Primer amount: NA
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Shh,TSS 5:28463004-28467172 AGGCTGGAGAGCTTGTGAGA +
Target
Locus2 Fragment location Primer sequence Strand
Shh,mammal fish conserved sequence 5:29314591-29316266 TGCCTATGACAGTGCAAGTGA +

4.Reference

Amano, T., et al. (2009). "Chromosomal dynamics at the Shh locus: limb bud-specific differential regulation of competence and active transcription." Dev Cell 16(1): 47-57.   PMID: 19097946

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.