Detail Information of mm0000039 [Genome Browser]
1.Basic Information

Name: mm0000039
Species: Mus musculus
Cell Line: embryo cells
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: 18
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Hbb-b1, promoter,segment e 7:103827237-103828268 AATCGCTGCTCCCCCTCACT -
Target
Locus2 Fragment location Primer sequence Strand
Hbb,HS-42,segment b 7:103890787-103892124 ATGAACAAGTTTCATGGGG -

4.Reference

Gavrilov, A. A., et al. (2013). "Actual Ligation Frequencies in the Chromosome Conformation Capture Procedure." PLoS One 8(3).   PMID: 23555968

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.