Detail Information of mm0000030 [Genome Browser]
1.Basic Information

Name: mm0000030
Species: Mus musculus
Cell Line: C57BL/6
Restriction Enzyme: BpmI

2.Experiment Infromation

Remark: in WT, Crx-/-, rd7
Primer amount: 8
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Gnat1,segment Pg1 9:107679511-107679814 TGTGGAGAGCCAGTTGATTG -
Target
Locus2 Fragment location Primer sequence Strand
Gnat1,segment E2 9:107677485-107679074 GTCTGAGGGCAAAATGTGC +

4.Reference

Peng, G. H. and S. Chen (2011). "Active opsin loci adopt intrachromosomal loops that depend on the photoreceptor transcription factor network." Proc Natl Acad Sci USA 108(43): 17821-17826.   PMID: 22006320

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.