Detail Information of mm0000001 [Genome Browser]
1.Basic Information

Name: mm0000001
Species: Mus musculus
Cell Line: C2C12
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: cultured under the conditions of GM-P and DM-C
Primer amount: 12
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Gls,5.5URR,segment 1 1:52110870-52115350 CCAGATTGAAATCACCTTTGTG -
Target
Locus2 Fragment location Primer sequence Strand
Gls,promoter,segment 5 1:52230751-52237220 ATCCTGTTCCCTCTCATCTTGC -

4.Reference

Yuasa, K., et al. (2012). "A conserved regulatory element located far downstream of the gls locus modulates gls expression through chromatin loop formation during myogenesis." FEBS Lett 586(19): 3464-3470.   PMID: 22979984

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.