Detail Information of hs0000092 [Genome Browser]
1.Basic Information

Name: hs0000092
Species: Homo sapiens
Cell Line: MCF7
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: contol: treatment, other cell line, nearby locus; ERÉ‘,AIB1,p300,AcH4; in the absence of hormone, specific distal PR regions still interact with the proximal PR region
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
PGR,proximal region 11:100996191-101001685 GTGGAAGTTAGGCAGATAGAG +
Target
Locus2 Fragment location Primer sequence Strand
PGR,distal 168 11:101163031-101165153 CTTGTGGAATAGTGTCAATACG +

4.Reference

Boney-Montoya, J., et al. (2010). "Long-range transcriptional control of progesterone receptor gene expression." Mol Endocrinol 24(2): 346-358.   PMID: 19952285

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.