Detail Information of hs0000913 [Genome Browser]
1.Basic Information

Name: hs0000913
Species: Homo sapiens
Cell Line: HEK293
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: CTCF-dependent interactions
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
KSHV,site 129020-129040,CTCF :129020-129040 KSHV-129020-129040-F :CAGCCCGATGGCCCTTCAGGC +
Target
Locus2 Fragment location Primer sequence Strand
KSHV,site 72888,5' primer segment :72568-72588 KSHV-72568-72588-F:TTAGGGTAAGAAGCTTCGGCG NA

4.Reference

Kang, H., et al. (2011). "Coordination of KSHV latent and lytic gene control by CTCF-cohesin mediated chromosome conformation." PLoS Pathog 7(8): e1002140.   PMID: 21876668

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.