Detail Information of hs0000911
1.Basic Information

Name: hs0000911
Species: Homo sapiens
Cell Line: HeLa
Restriction Enzyme: NlaIII

2.Experiment Infromation

Remark: control: no ligase; transfected: chloramphenicol acetyl-transferase (CAT) reporter plasmidsIFN-β enhancer 2.3 kbp upstream of the TK promote
Primer amount: NA
Test repetition: NA
Reliability Level: NA

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
IFN-β,enhancer,chloramphenicol acetyl transferase (CAT) NA ATTCCTCTGAATAGAGAGAGG NA
Target
Locus2 Fragment location Primer sequence Strand
sp1,chloramphenicol acetyl transferase (CAT) NA ACTTTCACTTCTCCCTTTCAG NA

4.Reference

Nolis, I. K., et al. (2009). "Transcription factors mediate long-range enhancer-promoter interactions." Proc Natl Acad Sci USA 106(48): 20222-20227.   PMID: 19923429

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.