Detail Information of hs0000901 [Genome Browser]
1.Basic Information

Name: hs0000901
Species: Homo sapiens
Cell Line: HMEC
Restriction Enzyme: NA

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Brca1,adjacent 2kb,segment 2 11:101551699-101551724 CCACCAGCAGCTTCCTGCCTTTCATA +
Target
Locus2 Fragment location Primer sequence Strand
Brca1,intron 2,segment 3 11:101546841-101546866 CACCCTAAGCATTGAGACGGGCCTTT +

4.Reference

Tan-Wong, S. M., et al. (2008). "Dynamic interactions between the promoter and terminator regions of the mammalian BRCA1 gene." Proc Natl Acad Sci USA 105(13): 5160-5165.   PMID: 18375767

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.