Detail Information of hs0000885 [Genome Browser]
1.Basic Information

Name: hs0000885
Species: Homo sapiens
Cell Line: HeLa
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: control: no ligase and fators;Pdx1, NeuroD1, and E47;Dependent upon an Intact A3 Element, but not E2
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
Ins1,-623bp segment 19:52263796-52265179 TCTTTTTCTCTGGCATTTATTGTC +
Target
Locus2 Fragment location Primer sequence Strand
Ins1,+761bp segment 19:52263796-52265179 R: TCATTGGTCAACTGGGCTG -

4.Reference

Babu, D. A., et al. (2008). "Pdx1 and BETA2/NeuroD1 participate in a transcriptional complex that mediates short-range DNA looping at the insulin gene." Journal of Biological Chemistry 283(13): 8164-8172.   PMID: 18252719

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.