Detail Information of hs0000878 [Genome Browser]
1.Basic Information

Name: hs0000878
Species: Homo sapiens
Cell Line: brain cells
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: from the pic the author mailed
Primer amount: 14
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
PLAGL1,DMR,-5kb segment,segment C0 6:144332878-144333921 GTTGACCTGGTAGCTGTGACAC -
Target
Locus2 Fragment location Primer sequence Strand
PLAGL1,segment C12 6:144255051-144260542 CTCACAGGAGACAGTAGTAAGCC +

4.Reference

Iglesias-Platas, I., et al. (2013). "Imprinting at the PLAGL1 domain is contained within a 70-kb CTCF/cohesin-mediated non-allelic chromatin loop." Nucleic Acids Res 41(4): 2171-2179.   PMID: 23295672

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.