Detail Information of hs0000086
1.Basic Information

Name: hs0000086
Species: Homo sapiens
Cell Line: myoblasts
Restriction Enzyme: PvuII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
FSHD,4q35 tandemly arrayed 3.3-kb units ,D4Z4 NA CTCCCTCCTAACGTCCCTTC NA
Target
Locus2 Fragment location Primer sequence Strand
FRG1,promoter 4:190856230-190861926 CTCTAGCAGGAGGCGGTTC +

4.Reference

Bodega, B., et al. (2009). "Remodeling of the chromatin structure of the facioscapulohumeral muscular dystrophy (FSHD) locus and upregulation of FSHD-related gene 1 (FRG1) expression during human myogenic differentiation." BMC Biol 7: 41.   PMID: 19607661

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.