Detail Information of hs0000849 [Genome Browser]
1.Basic Information

Name: hs0000849
Species: Homo sapiens
Cell Line: HCT116
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
BUB1B 15:40407242-40409694 CCCAGCCTTAAATGACCAAC +
Target
Locus2 Fragment location Primer sequence Strand
BUB1B,promoter 15:40450115-40453909 TGTTAATGCTGCCTTACGTG +

4.Reference

Ochiai, H., et al. (2014). "TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome." Proc Natl Acad Sci USA 111(4): 1461-1466.   PMID: 24344301

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.