Detail Information of hs0000840 [Genome Browser]
1.Basic Information

Name: hs0000840
Species: Homo sapiens
Cell Line: C4-2B
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: higher in C4-2B than in LNCaP cells
Primer amount: 9
Test repetition: two
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
SYS1,promoter,AI-OR 20:43987659-43988426 GGCCAATGAAGCTAAACAAAGG +
Target
Locus2 Fragment location Primer sequence Strand
SLPI,promoter 20:43882236-43888879 CCCTCAAAAGTGGTGCTTTGT -

4.Reference

Decker, K. F., et al. (2012). "Persistent androgen receptor-mediated transcription in castration-resistant prostate cancer under androgen-deprived conditions." Nucleic Acids Res 40(21): 10765-10779.   PMID: 23019221

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.