Detail Information of hs0000084 [Genome Browser]
1.Basic Information

Name: hs0000084
Species: Homo sapiens
Cell Line: epididymis cells
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: control: ERCC3 gene; not primary human skin fibroblast cells
Primer amount: NA
Test repetition: two
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CFTR,promoter 7:117119359-117120898 GCAGTGTGGGTCTGATGCAT -
Target
Locus2 Fragment location Primer sequence Strand
CFTR,intron 19 7:117310322-117332213 CTGTGGTTTGAATGTGTTCCCTAA +

4.Reference

Blackledge, N. P., et al. (2009). "An insulator element 3' to the CFTR gene binds CTCF and reveals an active chromatin hub in primary cells." Nucleic Acids Res 37(4): 1086-1094.   PMID: 19129223

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.