Detail Information of hs0000832 [Genome Browser]
1.Basic Information

Name: hs0000832
Species: Homo sapiens
Cell Line: HT29
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: at least t
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CFTR,promoter 7:117119359-117120898 GCAGTGTGGGTCTGATGCAT -
Target
Locus2 Fragment location Primer sequence Strand
CFTR,intron 11,DHS 7:117224214-117233278 TGACTCTGATGTCAAATGTTTCTCAA +

4.Reference

Peng, G. H. and S. Chen (2011). "Active opsin loci adopt intrachromosomal loops that depend on the photoreceptor transcription factor network." Proc Natl Acad Sci USA 108(43): 17821-17826.   PMID: 22006320

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.