Detail Information of hs0000082 [Genome Browser]
1.Basic Information

Name: hs0000082
Species: Homo sapiens
Cell Line: HCT116
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: greatly reduced up to 60% after B-CATENIN knockdown
Primer amount: 10
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
VEGFA,segment 5,TBE1 6:43735590-43736663 CTGTGAGCCTGGAGAAGTAGCC +
Target
Locus2 Fragment location Primer sequence Strand
VEGFA,segment 14 6:43758342-43762743 CTCTCTGATTAGCCCGTGTGC +

4.Reference

Hwang, I., et al. (2012). "beta-Catenin and peroxisome proliferator-activated receptor-delta coordinate dynamic chromatin loops for the transcription of vascular endothelial growth factor A gene in colon cancer cells." Journal of Biological Chemistry 287(49): 41364-41373.   PMID: 23086933

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.