Detail Information of hs0000817 [Genome Browser]
1.Basic Information

Name: hs0000817
Species: Homo sapiens
Cell Line: RKO
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: 9
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
MYC,enhancer 8:128413010-128414109 TGTGGTCCCTGAACTTCTAAAA +
Target
Locus2 Fragment location Primer sequence Strand
CCAT1,segment 2 8:128226854-128233035 TCCAGAATCTTGTTAGAACTTGG -

4.Reference

Kim, T., et al. (2014). "Long-range interaction and correlation between MYC enhancer and oncogenic long noncoding RNA CARLo-5." Proc Natl Acad Sci USA 111(11): 4173-4178.   PMID: 24594601

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.