Detail Information of hs0000808
1.Basic Information

Name: hs0000808
Species: Homo sapiens
Cell Line: brain cells
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: 11
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
PLAGL1,P3/P4 promoter 6:144279993-144282468 GAAACCAGCATTTCCGTTCACC +
Target
Locus2 Fragment location Primer sequence Strand
PLAGL1,DMR,-5kb segment NA NA NA

4.Reference

Iglesias-Platas, I., et al. (2013). "Imprinting at the PLAGL1 domain is contained within a 70-kb CTCF/cohesin-mediated non-allelic chromatin loop." Nucleic Acids Res 41(4): 2171-2179.   PMID: 23295672

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.