Detail Information of hs0000762 [Genome Browser]
1.Basic Information

Name: hs0000762
Species: Homo sapiens
Cell Line: Jurkat
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: control: uncut and no ligase
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
ARNT2,intron 7,GATA3 15:80767174-80770055 GGCACAATACACTGACAGA -
Target
Locus2 Fragment location Primer sequence Strand
ARNT2,core promoter 15:80694591-80699347 CGCACACACACATTTAACCA -

4.Reference

Fullwood, M. J., et al. (2009). "An oestrogen-receptor-alpha-bound human chromatin interactome." Nature 462(7269): 58-64.   PMID: 19890323

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.