Detail Information of hs0000752 [Genome Browser]
1.Basic Information

Name: hs0000752
Species: Homo sapiens
Cell Line: MCF7
Restriction Enzyme: MseI

2.Experiment Infromation

Remark: Chip-3C validation CHIA-PET; control: oestrogen treated
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
GREB1,segment pet 2 3:150455051-150455435 CAAAGCACTTTGCACACGAT +
Target
Locus2 Fragment location Primer sequence Strand
GREB1,segment pet 3 3:150474271-150474485 CTCTACCACAGAACGGGAGAG +

4.Reference

Fullwood, M. J., et al. (2009). "An oestrogen-receptor-alpha-bound human chromatin interactome." Nature 462(7269): 58-64.   PMID: 19890323

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.