Detail Information of hs0000724
1.Basic Information

Name: hs0000724
Species: Homo sapiens
Cell Line: HEK293
Restriction Enzyme: SphI

2.Experiment Infromation

Remark: control: nearby locus; LNO2(nitro-linoleic acid) treatment
Primer amount: NA
Test repetition: NA
Reliability Level: NA

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
HMHO1,promoter,cAMP-response element NA GCCTCCTGGGTTCAAGCGATT NA
Target
Locus2 Fragment location Primer sequence Strand
HO-1HMHO1,promoter,E-box element 22:35774663-35777550 CCAGTTCCTGGAATAGTGCCTGG -

4.Reference

Wright, M. M., et al. (2009). "Human haem oxygenase-1 induction by nitro-linoleic acid is mediated by cAMP, AP-1 and E-box response element interactions." Biochem J 422(2): 353-361.   PMID: 19534727

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.