Detail Information of hs0000717 [Genome Browser]
1.Basic Information

Name: hs0000717
Species: Homo sapiens
Cell Line: Jurkat
Restriction Enzyme: DpnII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
LTB.exon 4 6:31547296-31548980 TCGTCGTCTCCCAGCCTA +
Target
Locus2 Fragment location Primer sequence Strand
LTB,promoter 6:31543683-31544547 CACTCACCTCTTCCCTCTGG -

4.Reference

Wicks, K. and J. C. Knight (2011). "Transcriptional repression and DNA looping associated with a novel regulatory element in the final exon of the lymphotoxin-beta gene." Genes Immun 12(2): 126-135.   PMID: 21248773

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.