Detail Information of hs0000071 [Genome Browser]
1.Basic Information

Name: hs0000071
Species: Homo sapiens
Cell Line: Hep G2
Restriction Enzyme: BglII/BclI

2.Experiment Infromation

Remark: HNF-4alpha;not Hela cell;untreatment or PMA for 24 h, not PMA for 6h; not cells transfected with C/EBPalpha
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
HNF4,proximal promoter 20:43022349-43025518 GGCTCTGACACTGCAGAGTTCTAGAAC +
Target
Locus2 Fragment location Primer sequence Strand
HNF4,distant enhancer 20:44396501-44401920 TCGAGGGGTGGGGGTAATGGTTAATCGG NA

4.Reference

Hatzis, P., et al. (2006). "Mitogen-activated protein kinase-mediated disruption of enhancer-promoter communication inhibits hepatocyte nuclear factor 4alpha expression." Mol Cell Biol 26(19): 7017-7029.   PMID: 16980607

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.