Detail Information of hs0000007 [Genome Browser]
1.Basic Information

Name: hs0000007
Species: Homo sapiens
Cell Line: HCT116
Restriction Enzyme: BstYI

2.Experiment Infromation

Remark: MYC5'3' loop
Primer amount: 10
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
MYC 8:128757028-128761141 CTGTCACATTCTTCCAGCTGG -
Target
Locus2 Fragment location Primer sequence Strand
MYC 8:128748252-128748588 TGTAGTAATTCCAGCGAGAGGC +

4.Reference

Yochum, G. S., et al. (2010). "A beta-catenin/TCF-coordinated chromatin loop at MYC integrates 5' and 3' Wnt responsive enhancers." Proc Natl Acad Sci USA 107(1): 145-150.   PMID: 19966299

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.