Detail Information of hs0000694 [Genome Browser]
1.Basic Information

Name: hs0000694
Species: Homo sapiens
Cell Line: THP-1
Restriction Enzyme: PstI

2.Experiment Infromation

Remark: not HepG2
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
APOC2,+1378kb segment 19:45444956-45450670 GCCCTAAGGTAACACATTTGATC +
Target
Locus2 Fragment location Primer sequence Strand
APOC2,-2712kb segment 19:45427522-45429205 GACAACCTCTGCTCCTCTCCACCG -

4.Reference

Trusca, V. G., et al. (2012). "STAT1 interacts with RXRalpha to upregulate ApoCII gene expression in macrophages." PLoS One 7(7): e40463.   PMID: 22808166

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.