Detail Information of hs0000693 [Genome Browser]
1.Basic Information

Name: hs0000693
Species: Homo sapiens
Cell Line: LNCaP
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: two controls(GADPH loading/Bgl II control)
Primer amount: 10
Test repetition: two to fou
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
ABCC4,promoter 13:95952033-95957007 GAGTGGCGGGTGTGTGTG -
Target
Locus2 Fragment location Primer sequence Strand
ABCC4,enhancer,GATA2 13:95923610-95926048 GTGACCTTCTTATCCTCTGCTTCC -

4.Reference

Wu, D., et al. (2014). "Three-tiered role of the pioneer factor GATA2 in promoting androgen-dependent gene expression in prostate cancer." Nucleic Acids Res 42(6): 3607-3622.   PMID: 24423874

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.