Detail Information of hs0000692 [Genome Browser]
1.Basic Information

Name: hs0000692
Species: Homo sapiens
Cell Line: HEK293
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: 26
Test repetition: two
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
KCNK9,promoter 8:141163544-141170921 GCCATATGTAATATACTATACGCAGGTG -
Target
Locus2 Fragment location Primer sequence Strand
PEG1, promoter 8:141116727-141122213 GACTTGCAGTCTGTTTCTCTTGC -

4.Reference

Court, F., et al. (2014). "The PEG13-DMR and brain-specific enhancers dictate imprinted expression within the 8q24 intellectual disability risk locus." Epigenetics Chromatin 7(1): 5.   PMID: 24667089

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.