Detail Information of hs0000687 [Genome Browser]
1.Basic Information

Name: hs0000687
Species: Homo sapiens
Cell Line: hES
Restriction Enzyme: MspI

2.Experiment Infromation

Remark: compared to ES cells
Primer amount: 19
Test repetition: two to thr
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
EOMES,enhancer 3:27771052-27771768 GATGACCGATTCTACCGCAAA -
Target
Locus2 Fragment location Primer sequence Strand
EOMES,promoter 3:27763529-27763619 GCGGCCATGCTTAGTGACA -

4.Reference

Kartikasari, A. E., et al. (2013). "The histone demethylase Jmjd3 sequentially associates with the transcription factors Tbx3 and Eomes to drive endoderm differentiation." EMBO J 32(10): 1393-1408.   PMID: 23584530

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.