Detail Information of hs0000068 [Genome Browser]
1.Basic Information

Name: hs0000068
Species: Homo sapiens
Cell Line: Caco-2
Restriction Enzyme: NA

2.Experiment Infromation

Remark: FOXA1/A2 depletion
Primer amount: 17
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CFTR,promoter 7:117119404-117119423 GCAGTGTGGGTCTGATGCAT -
Target
Locus2 Fragment location Primer sequence Strand
CFTR,3' insulators,segment III 7:117326509-117326532 CTGTGGTTTGAATGTGTTCCCTAA _

4.Reference

Gosalia, N., et al. (2014). "Architectural proteins CTCF and cohesin have distinct roles in modulating the higher order structure and expression of the CFTR locus." Nucleic Acids Res 42(15): 9612-9622.   PMID: 25081205

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.