Detail Information of hs0000646 [Genome Browser]
1.Basic Information

Name: hs0000646
Species: Homo sapiens
Cell Line: NOMO-1
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: treatment: Brg1 knockdown
Primer amount: 31
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
MYC,segment CTD-2034C18 8:128745463-128751378 GGCTGGATACCTTTCCCATT +
Target
Locus2 Fragment location Primer sequence Strand
MYC,enhancer,segment E5 8:130676369-130680841 ACCTGATGGGAGATCATTCAA +

4.Reference

Shi, J., et al. (2013). "Role of SWI/SNF in acute leukemia maintenance and enhancer-mediated Myc regulation." Genes Dev 27(24): 2648-2662.   PMID: 24285714

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.