Detail Information of hs0000640 [Genome Browser]
1.Basic Information

Name: hs0000640
Species: Homo sapiens
Cell Line: U937
Restriction Enzyme: NspI

2.Experiment Infromation

Remark: RA treatment chromatin change;in the presence of retinoic acid(RA), GA-binding protein(GABP) and p300 at the proximal promoter recruit retinoic acid receptor/retinoid X receptor from a distal RARE to form an enhanceosome
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
ITGB2,enhanceosome,proximal promoter 21:46340319-46340986 TAGAAACCTCAGCTGGAGGC +
Target
Locus2 Fragment location Primer sequence Strand
ITGB2,distal enhancer 21:46341782-46342263 GAAGGCAGAGGTGGATGGA -

4.Reference

Resendes, K. K. and A. G. Rosmarin (2006). "GA-binding protein and p300 are essential components of a retinoic acid-induced enhanceosome in myeloid cells." Mol Cell Biol 26(8): 3060-3070.   PMID: 16581781

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.