Detail Information of hs0000064 [Genome Browser]
1.Basic Information

Name: hs0000064
Species: Homo sapiens
Cell Line: MCF7
Restriction Enzyme: BstYI

2.Experiment Infromation

Remark: AP-2 gis required for efficient ERabinding; E2 stimulation
Primer amount: 11
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
RET,segment B 10:43522179-43522784 AACCCCGTGTGTCCTTCAG +
Target
Locus2 Fragment location Primer sequence Strand
RET,segment J 10:43605070-43606784 CTAGGGGTGGTCACCTCAGC +

4.Reference

Tan, S. K., et al. (2011). "AP-2gamma regulates oestrogen receptor-mediated long-range chromatin interaction and gene transcription." EMBO J 30(13): 2569-2581.   PMID: 21572391

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.