Detail Information of hs0000638 [Genome Browser]
1.Basic Information

Name: hs0000638
Species: Homo sapiens
Cell Line: SU-DHL-16?
Restriction Enzyme: EcoRI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: at least t
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
BCL6,promoter 3:187460270-187463597 TGCTCCGCCACCATCAC +
Target
Locus2 Fragment location Primer sequence Strand
BCL6,-60 kb segment 3:187530108-187539752 GATGAGAAAAGCTTGTAAAAATCGAA +

4.Reference

Ramachandrareddy, H., et al. (2010). "BCL6 promoter interacts with far upstream sequences with greatly enhanced activating histone modifications in germinal center B cells." Proc Natl Acad Sci USA 107(26): 11930-11935.   PMID: 20547840

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.