Detail Information of hs0000627 [Genome Browser]
1.Basic Information

Name: hs0000627
Species: Homo sapiens
Cell Line: A549
Restriction Enzyme: DpnII

2.Experiment Infromation

Remark: MM treatment
Primer amount: 10
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
PTGS2,promoter,segment C1 1:186649906-186650632 TCAGATTCCTGGAGAGGAAG -
Target
Locus2 Fragment location Primer sequence Strand
PLA2G4A,promoter,segment T5 1:186797342-186798124 CCTACTCAGGATAAGACTTTCTC +

4.Reference

Matsui, M., et al. (2013). "Promoter RNA links transcriptional regulation of inflammatory pathway genes." Nucleic Acids Res 41(22): 10086-10109.   PMID: 23999091

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.