Detail Information of hs0000062 [Genome Browser]
1.Basic Information

Name: hs0000062
Species: Homo sapiens
Cell Line: T cells
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: fixed fragment located five (rat) or two (human) BglII restriction fragments (~10 kb) upstream of Fbxo10/FBXO10 promoter
Primer amount: 19
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
MCS5A2 9:37589849-37593162 GGGGCTGTGCACATAGGTA +
Target
Locus2 Fragment location Primer sequence Strand
FRMPD1,+14.5kb segment 9:37604336-37607822 TTACAGGGTCGGGGATTTATAGT +

4.Reference

Smits, B. M., et al. (2012). "An insulator loop resides between the synthetically interacting elements of the human/rat conserved breast cancer susceptibility locus MCS5A/Mcs5a." Nucleic Acids Res 40(1): 132-147.   PMID: 21914726

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.