Detail Information of hs0000617 [Genome Browser]
1.Basic Information

Name: hs0000617
Species: Homo sapiens
Cell Line: Y79
Restriction Enzyme: BpmI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: three
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
OPN1LW,OPN1MW,enhancer,LCR X:153404622-153408191 TTTTGTGTCTGGCTTCGCTC +
Target
Locus2 Fragment location Primer sequence Strand
OPN1LW,promoter X:153409195-153410908 GTGGTTCTCTTGAAAGCCCAG NA

4.Reference

Peng, G. H. and S. Chen (2011). "Active opsin loci adopt intrachromosomal loops that depend on the photoreceptor transcription factor network." Proc Natl Acad Sci USA 108(43): 17821-17826.   PMID: 22006320

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.