Detail Information of hs0000577 [Genome Browser]
1.Basic Information

Name: hs0000577
Species: Homo sapiens
Cell Line: Caco-2
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: at least t
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CFTR,promoter 7:117119359-117120898 GCAGTGTGGGTCTGATGCAT -
Target
Locus2 Fragment location Primer sequence Strand
CFTR,intron 10,DHS 7:117212906-117213193 ACCCTATATCATTGCCCTTTGTATG +

4.Reference

Ott, C. J., et al. (2009). "Intronic enhancers coordinate epithelial-specific looping of the active CFTR locus." Proc Natl Acad Sci USA 106(47): 19934-19939.   PMID: 19897727

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.