Detail Information of hs0000571 [Genome Browser]
1.Basic Information

Name: hs0000571
Species: Homo sapiens
Cell Line: THP-1
Restriction Enzyme: BpmI

2.Experiment Infromation

Remark: γ-actin gene a loading control(different cell line); compare with different cell line; PCR products in nonpermissive Raji and Jurkat cells are much greater than in THP-1 cells
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CD68,promoter 17:7482499-7482886 GCACCCATGTGACACTGTTG +
Target
Locus2 Fragment location Primer sequence Strand
CD68,3′UTR,segment primer 3 17:7484032-7484213 GTGCTGCGTGGGGGAAGGAC -

4.Reference

O'Reilly, D. and D. R. Greaves (2007). "Cell-type-specific expression of the human CD68 gene is associated with changes in Pol II phosphorylation and short-range intrachromosomal gene looping." Genomics 90(3): 407-415.   PMID: 17583472

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.