Detail Information of hs0000558 [Genome Browser]
1.Basic Information

Name: hs0000558
Species: Homo sapiens
Cell Line: HB2
Restriction Enzyme: BamHI

2.Experiment Infromation

Remark: Depletion of cohesin by siRNA results in ablation of the CTCF-mediated loops
Primer amount: NA
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
H19,downstream enhancer,segment m 11:2008020-2008974 CCTTCCTGCTGCTCAGAGGTT +
Target
Locus2 Fragment location Primer sequence Strand
H19,CCD,segment h 11:2046498-2058354 AACAAAATTTCAGCCGGTTCA +

4.Reference

Nativio, R., et al. (2009). "Cohesin is required for higher-order chromatin conformation at the imprinted IGF2-H19 locus." PLoS Genet 5(11): e1000739.   PMID: 19956766

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.