Detail Information of hs0000545 [Genome Browser]
1.Basic Information

Name: hs0000545
Species: Homo sapiens
Cell Line: FSHD
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: NA
Primer amount: 19
Test repetition: at least t
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
DUX4,promoter,segment primer3 4:190996095-190999393 AGATTTGGTTTCAGAATGAGAGGTC +
Target
Locus2 Fragment location Primer sequence Strand
FRG2,segment primer11 4:190948278-190951834 GGCCTATTGTACTGTTTCTTTTATTTTG +

4.Reference

Himeda, C. L., et al. (2014). "Myogenic Enhancers Regulate Expression of the Facioscapulohumeral Muscular Dystrophy-Associated DUX4 Gene." Mol Cell Biol 34(11): 1942-1955.   PMID: 24636994

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.