Detail Information of hs0000540 [Genome Browser]
1.Basic Information

Name: hs0000540
Species: Homo sapiens
Cell Line: HeLa
Restriction Enzyme: HpaII/MspI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: I

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
IGS,segment h18 16:33950156-33950467 AGTCCACCCTGTACGTCAACC -
Target
Locus2 Fragment location Primer sequence Strand
IGS,segment h37 16:143917-143937 TCTGCCGTGAAACTGTCTGTC -

4.Reference

Shiue, C. N., et al. (2014). "Myc-induced anchorage of the rDNA IGS region to nucleolar matrix modulates growth-stimulated changes in higher-order rDNA architecture." Nucleic Acids Res 42(9): 5505-5517.   PMID: 24609384

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.