Detail Information of hs0000532 [Genome Browser]
1.Basic Information

Name: hs0000532
Species: Homo sapiens
Cell Line: HCT116
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: reduced in TIG-1 fibroblasts
Primer amount: 6
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
MYC,promoter 8:128745990-128756984 AGCAGCAGATACCGCCCCTCCT -
Target
Locus2 Fragment location Primer sequence Strand
MYC,enhancer,segment D 8:128256948-128263221 GCACAGACGAGGAGCAGTC -

4.Reference

Yochum, G. S. (2011). "Multiple Wnt/ss-catenin responsive enhancers align with the MYC promoter through long-range chromatin loops." PLoS One 6(4): e18966.   PMID: 21533051

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.