Detail Information of hs0000053 [Genome Browser]
1.Basic Information

Name: hs0000053
Species: Homo sapiens
Cell Line: THP-1
Restriction Enzyme: NlaIII

2.Experiment Infromation

Remark: NA
Primer amount: 31
Test repetition: three
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
TNFAIP3,TT>A enhancer 6:138229431-138234409 GTTCAGGGGTATGCCCGAAGCTAA -
Target
Locus2 Fragment location Primer sequence Strand
TNFAIP3,segment7 6:138183353-138205585 TCAGTTCACCCCAGGGTGCTGAT -

4.Reference

Wang, S., et al. (2013). "An enhancer element harboring variants associated with systemic lupus erythematosus engages the TNFAIP3 promoter to influence A20 expression." PLoS Genet 9(9): e1003750.   PMID: 24039598

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.