Detail Information of hs0000529
1.Basic Information

Name: hs0000529
Species: Homo sapiens
Cell Line: Caco-2
Restriction Enzyme: HindIII

2.Experiment Infromation

Remark: NA
Primer amount: 15
Test repetition: NA
Reliability Level: III

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CFTR,promoter 7:117119359-117120898 GCAGTGTGGGTCTGATGCAT -
Target
Locus2 Fragment location Primer sequence Strand
CFTR,+15.6 kb DHS NA NA NA

4.Reference

Zhang, Z., et al. (2012). "Molecular mechanisms controlling CFTR gene expression in the airway." J Cell Mol Med 16(6): 1321-1330.   PMID: 21895967

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.