Detail Information of hs0000518 [Genome Browser]
1.Basic Information

Name: hs0000518
Species: Homo sapiens
Cell Line: Hep3B
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: GAPDH;CTCF and cohesins knockdown interaction decrease;AC3 primer 17 is anchor,primer16 is peak
Primer amount: NA
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
APOC3,enhancer,segment AR1 11:116690981-116704772 CACTCCTATGTCAGGTGTTAGGG +
Target
Locus2 Fragment location Primer sequence Strand
APOA5,promoter,segment AC2 11:116655825-116663782 GAAAAGCTGAACTCCACTCG +

4.Reference

Mishiro, T., et al. (2009). "Architectural roles of multiple chromatin insulators at the human apolipoprotein gene cluster." EMBO J 28(9): 1234-1245.   PMID: 19322193

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.