Detail Information of hs0000504 [Genome Browser]
1.Basic Information

Name: hs0000504
Species: Homo sapiens
Cell Line: HEK293
Restriction Enzyme: KpnI

2.Experiment Infromation

Remark: control: negtive locus, no cross-linking, no ligase; not in non-hWNK4-expressing Hela cells
Primer amount: NA
Test repetition: three
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
WNK4, promoter 17:40913921-40933662 GAGGTGGAAAATAGGATGGGAAGT +
Target
Locus2 Fragment location Primer sequence Strand
WNK4, enhancer 17:40948634-40949316 GGCGTTCTTGTTTCCAGCATT -

4.Reference

Mao, J., et al. (2010). "Human with-no-lysine kinase-4 3'-UTR acting as the enhancer and being targeted by miR-296." Int J Biochem Cell Biol 42(9): 1536-1543.   PMID: 20561597

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.