Detail Information of hs0000503 [Genome Browser]
1.Basic Information

Name: hs0000503
Species: Homo sapiens
Cell Line: Hep G2
Restriction Enzyme: BsrGI

2.Experiment Infromation

Remark: NA
Primer amount: NA
Test repetition: NA
Reliability Level: II

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CYP2C9,promoter distal -2201 AP-1 site,cFos 10:96695527-96696715 AACATTGACGCATCATCATCA -
Target
Locus2 Fragment location Primer sequence Strand
CYP2C9,promoter proximal -1930 AP site,JunD 10:96695527-96696715 TACTAGACTGAATTACGAAAT +

4.Reference

Makia, N. L., et al. (2014). "Regulation of Human CYP2C9 Expression by Electrophilic Stress Involves AP-1 Activation and DNA Looping." Mol Pharmacol.   PMID: 24830941

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.