Detail Information of hs0000495 [Genome Browser]
1.Basic Information

Name: hs0000495
Species: Homo sapiens
Cell Line: THP-1
Restriction Enzyme: BglII

2.Experiment Infromation

Remark: EBV-transformed B cell line, the monocyte-like line THP-1 and the lung epithelial cell line A549
Primer amount: 14
Test repetition: NA
Reliability Level: IV

3.Locus Information

Anchor
Locus1 Fragment location Primer sequence Strand
CLEC16A,intron 19 16:11198767-11198786 GCTTCCGAAGACCAGGATAC +
Target
Locus2 Fragment location Primer sequence Strand
DEXI,promoter 16:11036502-11036868 GGTTTGAACTGTGTTCAGTCTCTTT -

4.Reference

Davison, L. J., et al. (2012). "Long-range DNA looping and gene expression analyses identify DEXI as an autoimmune disease candidate gene." Hum Mol Genet 21(2): 322-333.   PMID: 21989056

©BIG 2015, Beijing Institute of Genomics, Chinese Academy of Sciences
NO.1 Beichen West Road, Chaoyang District, Beijing 100101, China.